Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 2841662
End position: 2841687
Length: 26

DNA sequence
>NC_003552, from 2841662 to 2841687 (26 bp); Methanosarcina acetivorans str. C2A TCTACTCTGCTTTACTCTACTCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2841679-2843070	Sequence	MA2309 - hypothetical protein (Protein is coded in complementary strand; from 2843070 to 2841679)