Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 2804393
End position: 2804428
Length: 36

DNA sequence
>NC_003552, from 2804393 to 2804428 (36 bp); Methanosarcina acetivorans str. C2A ACGGGTTGAGGAACAGGTTGAGAAACTGGTTGAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2803627-2804778	Sequence	MA2282 modC molydbenum ABC transporter ATP-binding protein