Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 2781070
End position: 2781117
Length: 48

DNA sequence
>NC_003552, from 2781070 to 2781117 (48 bp); Methanosarcina acetivorans str. C2A TTATTTTCTCTTTTATTTTCTTTTTTGCTTTCTCTTTTATTTTCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2780380-2781462	Sequence	MA2259 - hypothetical protein (Protein is coded in complementary strand; from 2781462 to 2780380)