Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 258643
End position: 258685
Length: 43

DNA sequence
>NC_003552, from 258643 to 258685 (43 bp); Methanosarcina acetivorans str. C2A CTTTATCATCTTCCCTTCTCATCTTCCTTTTTCATTTTCCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 258675-259343	Sequence	MA0214 - hypothetical protein (Protein is coded in complementary strand; from 259343 to 258675)