Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 2488370
End position: 2488414
Length: 45

DNA sequence
>NC_003552, from 2488370 to 2488414 (45 bp); Methanosarcina acetivorans str. C2A ATATCTGACTGTTTGTAATCGGACTGTTTGAAATCGGACTGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2487679-2488758	Sequence	MA2006 - hypothetical protein (Protein is coded in complementary strand; from 2488758 to 2487679)