Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 2468522
End position: 2468573
Length: 52

DNA sequence
>NC_003552, from 2468522 to 2468573 (52 bp); Methanosarcina acetivorans str. C2A ATTTTCGCATTGATGCTATTTTTGCATTGATGCTATTTTTGCATTGATGCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2468538-2468741	Sequence	MA1992 - hypothetical protein (Protein is coded in complementary strand; from 2468741 to 2468538)