Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 24596
End position: 24658
Length: 63

DNA sequence
>NC_003552, from 24596 to 24658 (63 bp); Methanosarcina acetivorans str. C2A AAAGAAGTATTAATGAATATTGAAGGAATATAAATGAATATTGATGGAGTATAAATGAATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 24606-25085	Sequence	MA0017 dyhC dynein heavy chain (Protein is coded in complementary strand; from 25085 to 24606)