Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 2305731
End position: 2305760
Length: 30

DNA sequence
>NC_003552, from 2305731 to 2305760 (30 bp); Methanosarcina acetivorans str. C2A TTGATTGATTTTGATAGATATTGATAGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2304421-2305842	Sequence	MA1868 - hypothetical protein (Protein is coded in complementary strand; from 2305842 to 2304421)