Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 229661
End position: 229690
Length: 30

DNA sequence
>NC_003552, from 229661 to 229690 (30 bp); Methanosarcina acetivorans str. C2A TTCATTTTTCTTCAATTTTCTTTAATTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 229690-230487	Sequence	MA0191 - hypothetical protein (Protein is coded in complementary strand; from 230487 to 229690)