Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 2264069
End position: 2264093
Length: 25

DNA sequence
>NC_003552, from 2264069 to 2264093 (25 bp); Methanosarcina acetivorans str. C2A TCTTCATCTGCATATTCATCTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2263100-2267143	Sequence	MA1839 - hypothetical protein (Protein is coded in complementary strand; from 2267143 to 2263100)