Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 2201060
End position: 2201101
Length: 42

DNA sequence
>NC_003552, from 2201060 to 2201101 (42 bp); Methanosarcina acetivorans str. C2A GAAGGCAGAAGAGTGAAGCCAGAAGAGTAAAGCCAGAAGAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2199790-2201076	Sequence	MA1790 thiC thiamine biosynthesis protein ThiC