Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 218628
End position: 218677
Length: 50

DNA sequence
>NC_003552, from 218628 to 218677 (50 bp); Methanosarcina acetivorans str. C2A TGCTAATATCGCTGCTAATATCGCTGCTAATATCGCTGCTAATATCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 218588-220432	Sequence	MA0185 - multidrug efflux protein (Protein is coded in complementary strand; from 220432 to 218588)