Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 2062038
End position: 2062082
Length: 45

DNA sequence
>NC_003552, from 2062038 to 2062082 (45 bp); Methanosarcina acetivorans str. C2A GGTTGATTATCCGGTTGATTGTCCGGTTGATTATCCGGTTGATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2062034-2062246	Sequence	MA1720 - hypothetical protein (Protein is coded in complementary strand; from 2062246 to 2062034)