Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 2038757
End position: 2038786
Length: 30

DNA sequence
>NC_003552, from 2038757 to 2038786 (30 bp); Methanosarcina acetivorans str. C2A TTCTTCTTCTACTACTTCCTCTTCTTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2038743-2039132	Sequence	MA1700 - hypothetical protein (Protein is coded in complementary strand; from 2039132 to 2038743)