Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 1816804
End position: 1816850
Length: 47

DNA sequence
>NC_003552, from 1816804 to 1816850 (47 bp); Methanosarcina acetivorans str. C2A TGCTGATTCTATGCCTGCTGATTCTATGCCTGTTGATTCTATGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1815791-1816861	Sequence	MA1536 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 1816861 to 1815791)