Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 1689241
End position: 1689264
Length: 24

DNA sequence
>NC_003552, from 1689241 to 1689264 (24 bp); Methanosarcina acetivorans str. C2A TTTTTCTTCTTCTCTTTCTTTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1689233-1689646	Sequence	MA1421 - hypothetical protein (Protein is coded in complementary strand; from 1689646 to 1689233)