Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 1476658
End position: 1476681
Length: 24

DNA sequence
>NC_003552, from 1476658 to 1476681 (24 bp); Methanosarcina acetivorans str. C2A TAATTTTAAATTTTGAATTTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1475412-1476947	Sequence	MA1242 - hypothetical protein (Protein is coded in complementary strand; from 1476947 to 1475412)