Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 1456767
End position: 1456809
Length: 43

DNA sequence
>NC_003552, from 1456767 to 1456809 (43 bp); Methanosarcina acetivorans str. C2A TAATCGAAATCGGGTACTCAAAATCGGGTACTTGAAATCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1456810-1457757	Sequence	MA1224 - hypothetical protein (Protein is coded in complementary strand; from 1457757 to 1456810)