Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 1275268
End position: 1275307
Length: 40

DNA sequence
>NC_003552, from 1275268 to 1275307 (40 bp); Methanosarcina acetivorans str. C2A ATTTAAATGCCTGGTTTGAATGCCTGGTTTAAATGCATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1275297-1275986	Sequence	MA1065 - hypothetical protein (Protein is coded in complementary strand; from 1275986 to 1275297)