Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 1037184
End position: 1037237
Length: 54

DNA sequence
>NC_003552, from 1037184 to 1037237 (54 bp); Methanosarcina acetivorans str. C2A CTGAGAAATTACAGGGTTCTGAGAAATTACAGTGTTCTGAGAAATTTCAGGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1035751-1039659	Sequence	MA0872 cobN cobaltochelatase subunit CobN (Protein is coded in complementary strand; from 1039659 to 1035751)