Sequence retrieval

Genome: Streptococcus pyogenes strain MGAS8232
Start position: 1549299
End position: 1549362
Length: 64

DNA sequence
>NC_003485, from 1549299 to 1549362 (64 bp); Streptococcus pyogenes strain MGAS8232 TGGTCAGTTGGTTTCGAATGGTCAGTTGGTTTCGAATGGTCAGTTGGTTTCGAATGGTCAGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1548150-1549697	Sequence	spyM18_1870 isp hypothetical protein (Protein is coded in complementary strand; from 1549697 to 1548150)