Sequence retrieval

Genome: Streptococcus pyogenes strain MGAS8232
Start position: 1735934
End position: 1735971
Length: 38

DNA sequence
>NC_003485, from 1735934 to 1735971 (38 bp); Streptococcus pyogenes strain MGAS8232 TTTTTCTGGTTTAGTTTCTGGTTTTTTGTCTGGTGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1735695-1739147	Sequence	spyM18_2074 scpA C5A peptidase (Protein is coded in complementary strand; from 1739147 to 1735695)