Sequence retrieval

Genome: Streptococcus pyogenes strain MGAS8232
Start position: 1244947
End position: 1244982
Length: 36

DNA sequence
>NC_003485, from 1244947 to 1244982 (36 bp); Streptococcus pyogenes strain MGAS8232 CTTCATCTAATTCATCTAATTCATCTAATTCATCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1244346-1245293	Sequence	spyM18_1512 - hypothetical protein (Protein is coded in complementary strand; from 1245293 to 1244346)