Sequence retrieval

Genome: Streptococcus pyogenes strain MGAS8232
Start position: 1626919
End position: 1626951
Length: 33

DNA sequence
>NC_003485, from 1626919 to 1626951 (33 bp); Streptococcus pyogenes strain MGAS8232 TTCTTCATCTTCTTCATCTTCTTCGTCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1626908-1627483	Sequence	spyM18_1960 rpoE DNA-directed RNA polymerase subunit delta (Protein is coded in complementary strand; from 1627483 to 1626908)