Sequence retrieval

Genome: Streptococcus pyogenes strain MGAS8232
Start position: 359374
End position: 359403
Length: 30

DNA sequence
>NC_003485, from 359374 to 359403 (30 bp); Streptococcus pyogenes strain MGAS8232 ATGGCAAATAAAGGCAAGTAATGGCTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 358750-359751	Sequence	spyM18_0436 fhuG ferrichrome ABC transporter permease (Protein is coded in complementary strand; from 359751 to 358750)