Sequence retrieval

Genome: Streptococcus pyogenes strain MGAS8232
Start position: 1230347
End position: 1230376
Length: 30

DNA sequence
>NC_003485, from 1230347 to 1230376 (30 bp); Streptococcus pyogenes strain MGAS8232 ACTGTCATGCACTGTTATTCACTGTCAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1230372-1230791	Sequence	spyM18_1485 - hypothetical protein (Protein is coded in complementary strand; from 1230791 to 1230372)