Sequence retrieval

Genome: Streptococcus pyogenes strain MGAS8232
Start position: 1653110
End position: 1653136
Length: 27

DNA sequence
>NC_003485, from 1653110 to 1653136 (27 bp); Streptococcus pyogenes strain MGAS8232 CTTTTTCCACCTTTTCCACTTATTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1651787-1654090	Sequence	spyM18_1982 - salivaricin A modification enzyme (Protein is coded in complementary strand; from 1654090 to 1651787)