Sequence retrieval

Genome: Streptococcus pyogenes strain MGAS8232
Start position: 1416960
End position: 1416986
Length: 27

DNA sequence
>NC_003485, from 1416960 to 1416986 (27 bp); Streptococcus pyogenes strain MGAS8232 TTTTCAAACTTTTCAAAGTTTTCAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1416708-1417625	Sequence	spyM18_1701 glyQ glycyl-tRNA synthetase subunit alpha (Protein is coded in complementary strand; from 1417625 to 1416708)