Sequence retrieval

Genome: Streptococcus pyogenes strain MGAS8232
Start position: 872357
End position: 872381
Length: 25

DNA sequence
>NC_003485, from 872357 to 872381 (25 bp); Streptococcus pyogenes strain MGAS8232 GCTGCTGCAGCTGCTGGTGGTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 872222-872683	Sequence	spyM18_1050 - hypothetical protein (Protein is coded in complementary strand; from 872683 to 872222)