Sequence retrieval

Genome: Streptococcus pyogenes strain MGAS8232
Start position: 805012
End position: 805035
Length: 24

DNA sequence
>NC_003485, from 805012 to 805035 (24 bp); Streptococcus pyogenes strain MGAS8232 ACAGCACCAGCAACAGTAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 804913-805089	Sequence	spyM18_0976 - hypothetical protein (Protein is coded in complementary strand; from 805089 to 804913)