Sequence retrieval

Genome: Streptococcus pyogenes strain MGAS8232
Start position: 1144796
End position: 1144819
Length: 24

DNA sequence
>NC_003485, from 1144796 to 1144819 (24 bp); Streptococcus pyogenes strain MGAS8232 CTTCATTTTCATCCTCATGTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1144768-1147146	Sequence	spyM18_1373 - internalin A (Protein is coded in complementary strand; from 1147146 to 1144768)