Sequence retrieval

Genome: Fusobacterium nucleatum subsp. nucleatum ATCC 25586
Start position: 814173
End position: 814196
Length: 24

DNA sequence
>NC_003454, from 814173 to 814196 (24 bp); Fusobacterium nucleatum subsp. nucleatum ATCC 25586 TTTAGTTCTAGTTTTACTTTTAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 814115-815773	Sequence	FN0190 - two-component sensor kinase YesM