Sequence retrieval

Genome: Fusobacterium nucleatum subsp. nucleatum ATCC 25586
Start position: 755534
End position: 755563
Length: 30

DNA sequence
>NC_003454, from 755534 to 755563 (30 bp); Fusobacterium nucleatum subsp. nucleatum ATCC 25586 ATTTTAAAATATTTTAACTTTTTTTAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 755548-756402	Sequence	FN0127 - Fe-S oxidoreductase (Protein is coded in complementary strand; from 756402 to 755548)