Sequence retrieval

Genome: Fusobacterium nucleatum subsp. nucleatum ATCC 25586
Start position: 682118
End position: 682147
Length: 30

DNA sequence
>NC_003454, from 682118 to 682147 (30 bp); Fusobacterium nucleatum subsp. nucleatum ATCC 25586 TTTTCTTTTTCATTCTCTCTTTCTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 680966-682219	Sequence	FN0042 - rod shape-determining protein RodA (Protein is coded in complementary strand; from 682219 to 680966)