Sequence retrieval

Genome: Fusobacterium nucleatum subsp. nucleatum ATCC 25586
Start position: 536202
End position: 536226
Length: 25

DNA sequence
>NC_003454, from 536202 to 536226 (25 bp); Fusobacterium nucleatum subsp. nucleatum ATCC 25586 TTTTTATTTTATTTTTTTATTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 536211-537173	Sequence	FN2031 - thiamine biosynthesis lipoprotein ApbE (Protein is coded in complementary strand; from 537173 to 536211)