Sequence retrieval

Genome: Fusobacterium nucleatum subsp. nucleatum ATCC 25586
Start position: 1987067
End position: 1987094
Length: 28

DNA sequence
>NC_003454, from 1987067 to 1987094 (28 bp); Fusobacterium nucleatum subsp. nucleatum ATCC 25586 ATATTTTTTATATTCTTTATATTTTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1986156-1987253	Sequence	FN1332 - peptide chain release factor 1 (Protein is coded in complementary strand; from 1987253 to 1986156)