Sequence retrieval

Genome: Fusobacterium nucleatum subsp. nucleatum ATCC 25586
Start position: 1774050
End position: 1774075
Length: 26

DNA sequence
>NC_003454, from 1774050 to 1774075 (26 bp); Fusobacterium nucleatum subsp. nucleatum ATCC 25586 TTAATTTTTTAATTTCTTTATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1772243-1774225	Sequence	FN1128 - acylamino acid-releasing protein (Protein is coded in complementary strand; from 1774225 to 1772243)