Sequence retrieval

Genome: Fusobacterium nucleatum subsp. nucleatum ATCC 25586
Start position: 1489823
End position: 1489847
Length: 25

DNA sequence
>NC_003454, from 1489823 to 1489847 (25 bp); Fusobacterium nucleatum subsp. nucleatum ATCC 25586 TCTTCATCTTCTTCTGCATCATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1489670-1489963	Sequence	FN0829 - hypothetical protein (Protein is coded in complementary strand; from 1489963 to 1489670)