Sequence retrieval

Genome: Corynebacterium glutamicum ATCC 13032 Kitasato
Start position: 775063
End position: 775092
Length: 30

DNA sequence
>NC_003450, from 775063 to 775092 (30 bp); Corynebacterium glutamicum ATCC 13032 Kitasato TTTCTGTTTCTGCTTCTGCTTCTGTTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 774147-777035	Sequence	NCgl0707 - SNF2 family helicase (Protein is coded in complementary strand; from 777035 to 774147)