Sequence retrieval

Genome: Corynebacterium glutamicum ATCC 13032 Kitasato
Start position: 359911
End position: 359958
Length: 48

DNA sequence
>NC_003450, from 359911 to 359958 (48 bp); Corynebacterium glutamicum ATCC 13032 Kitasato AGGCGCGACAACCTGGGGAGCGACAACCTGGGGCGCGACTGCCTGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 359759-360316	Sequence	NCgl0334 - hypothetical protein (Protein is coded in complementary strand; from 360316 to 359759)