Sequence retrieval

Genome: Corynebacterium glutamicum ATCC 13032 Kitasato
Start position: 28132
End position: 28161
Length: 30

DNA sequence
>NC_003450, from 28132 to 28161 (30 bp); Corynebacterium glutamicum ATCC 13032 Kitasato GGGACTGTTTAAGACTGTTTAGGACTGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 28161-29117	Sequence	NCgl0026 - ABC transporter periplasmic component (Protein is coded in complementary strand; from 29117 to 28161)