Sequence retrieval

Genome: Corynebacterium glutamicum ATCC 13032 Kitasato
Start position: 2649651
End position: 2649675
Length: 25

DNA sequence
>NC_003450, from 2649651 to 2649675 (25 bp); Corynebacterium glutamicum ATCC 13032 Kitasato CGCCACCGCAACCGCTACCGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2649593-2650168	Sequence	NCgl2411 - metalloendopeptidase-like protein