Sequence retrieval

Genome: Corynebacterium glutamicum ATCC 13032 Kitasato
Start position: 2642538
End position: 2642564
Length: 27

DNA sequence
>NC_003450, from 2642538 to 2642564 (27 bp); Corynebacterium glutamicum ATCC 13032 Kitasato GCTGGGGTTGCTGGGGTTGCTGGGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2638647-2647637	Sequence	NCgl2409 - 3-oxoacyl-ACP synthase (Protein is coded in complementary strand; from 2647637 to 2638647)