Sequence retrieval

Genome: Corynebacterium glutamicum ATCC 13032 Kitasato
Start position: 2598663
End position: 2598686
Length: 24

DNA sequence
>NC_003450, from 2598663 to 2598686 (24 bp); Corynebacterium glutamicum ATCC 13032 Kitasato TCTTTGTCTTTGTCTTTGTCTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2598660-2600813	Sequence	NCgl2370 - hypothetical protein (Protein is coded in complementary strand; from 2600813 to 2598660)