Sequence retrieval

Genome: Corynebacterium glutamicum ATCC 13032 Kitasato
Start position: 2441743
End position: 2441773
Length: 31

DNA sequence
>NC_003450, from 2441743 to 2441773 (31 bp); Corynebacterium glutamicum ATCC 13032 Kitasato CATGGGCATCATGGGCATCATCGGCATCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2441600-2443357	Sequence	NCgl2224 - hypothetical protein (Protein is coded in complementary strand; from 2443357 to 2441600)