Sequence retrieval

Genome: Corynebacterium glutamicum ATCC 13032 Kitasato
Start position: 2340271
End position: 2340322
Length: 52

DNA sequence
>NC_003450, from 2340271 to 2340322 (52 bp); Corynebacterium glutamicum ATCC 13032 Kitasato AAGGAAGAGCCAAAGAAGGAAGAGCCCAAGAAGGAAGAGCCCAAGAAGGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2339270-2341297	Sequence	NCgl2126 aceF dihydrolipoamide acetyltransferase