Sequence retrieval

Genome: Corynebacterium glutamicum ATCC 13032 Kitasato
Start position: 2031150
End position: 2031185
Length: 36

DNA sequence
>NC_003450, from 2031150 to 2031185 (36 bp); Corynebacterium glutamicum ATCC 13032 Kitasato CCAAAGCCCTGACCATTGCCCTGACCATTGCCCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2030274-2031365	Sequence	NCgl1851 - hypothetical protein (Protein is coded in complementary strand; from 2031365 to 2030274)