Sequence retrieval

Genome: Corynebacterium glutamicum ATCC 13032 Kitasato
Start position: 1937491
End position: 1937521
Length: 31

DNA sequence
>NC_003450, from 1937491 to 1937521 (31 bp); Corynebacterium glutamicum ATCC 13032 Kitasato TGCATCGTCTGCATCGTCTGCATCGTCTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1937483-1937737	Sequence	NCgl1751 - hypothetical protein (Protein is coded in complementary strand; from 1937737 to 1937483)