Sequence retrieval

Genome: Corynebacterium glutamicum ATCC 13032 Kitasato
Start position: 1774628
End position: 1774664
Length: 37

DNA sequence
>NC_003450, from 1774628 to 1774664 (37 bp); Corynebacterium glutamicum ATCC 13032 Kitasato GTTGTCGTCTCTGCTGTTGTCTCTGTTGTCGTTTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1774454-1775068	Sequence	NCgl1610 - hypothetical protein (Protein is coded in complementary strand; from 1775068 to 1774454)