Sequence retrieval

Genome: Corynebacterium glutamicum ATCC 13032 Kitasato
Start position: 1606377
End position: 1606400
Length: 24

DNA sequence
>NC_003450, from 1606377 to 1606400 (24 bp); Corynebacterium glutamicum ATCC 13032 Kitasato GTGTCGGTGACGGTGGCGGTGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1605858-1607657	Sequence	NCgl1467 - ABC transporter ATPase and permease (Protein is coded in complementary strand; from 1607657 to 1605858)